Lanterns: Sciency Stuff Part 2b: Enlightened Biology and Video-log

Blog

Sciency Stuff Part 2b: Enlightened Biology and Video-log

The Dialectic of Desire
Faith in Atheism: Sciency Stuff – 2b


Enlightened Biology and Video-log and Faith in Atheism’s Message – Decoded— A Cry from the Wilderness 

A Conservative Dialectic

Faith in Atheism is a series exploring the existence of a growing atheistic presence in the New World. What change will it bring to people who live free under Biblically sourced precepts such as Sovereign, Free Willed, and Individuals – equal in the eyes of the Creator?

“The fact remains that the materialistic view is a truncated view of reality.”
  
-- Stephen Meyer, Author - Signature in the Cell

Image may contain: text

Enlightened Biology 

Where to begin...
With all due respect to Stephen Meyer, I’ll start in the same manner he did in his book.

“aggtccgattcgattcaagtcgactagctagatcgatcgttcaagataaagcttcccgctgacagtctgtaacgttagagaagacccgtgtaaagagcccgcgcttctcaatataaaagctgacactgacactcagctcgaacagctccctgacggtgtgtgccacagctcgagctgtcgatttacacagcgctagtcgctacagcatcgactacgcatcagcggcatccgttaaggtgatctcgaaagatctagcgatc”
 
What in tarnation’s that?

That’s you... That’s what you look like in the pre-gleam stage. Well, sort of. The chance of me hitting these keys in this sequence and having this sequence line up precisely with any segment of the genetic sequence of any human being that has ever walked the surface of this planet is, for all intents and purposes, zero. This is how a geneticist would see you anyway.
Image may contain: one or more people

The Deoxynucleic Acid (DNA) Molecule which these letters represent is a molecular chain made up of four chemicals designated: A, C, T, and G. There are around 200 million of these chain links signified by the letters above in about three inches of DNA. The length of the human DNA chain is six feet long. Feel free to do the math and figure out how many links it takes to define one human and then multiply that by how many humans have ever existed on this planet if you’d like but I’m just going to go with a lot... A whole lot... This would be a huge, huge, astronomical figure pushing the envelope of the human brain’s ability to adequately process and understand.



That number pales in comparison to the odds that the chain I randomly typed in will match up with anybody’s, anywhere, and at any time. 

These stupefying numbers and odds will be gawked upon in Part Four of this series: 
Biological Probability.

 

“Chance and necessity do not explain the origins of life.”
   -- Stephen Meyer, Author - Signature in the Cell

I’m going to rely on a number of video links to show in a few minutes what I couldn’t begin to describe if my life depended on it. What they show is simply amazing. As the scale we are dealing with is on the molecular level, these videos are animations. What they depict are as real to life as science can approximate and it is given that they are adequate representations of life processes. I will add to what I’ve just paraphrased that I believe there is some additional coloring to separate and help clarify the individual goings on. This is just too small to observe directly. Again, what they depict is fascinating.

Take a look at the one first in line. This video shows a cell undergoing a change of function and processing the construction of different proteins (another type of manufactured and folded chemical chain also seen in Pt.4) in response to a signal it received from other cells. This cell has undergone an emergency, system-wide reset to produce the fabrications necessary to construct white blood cells. That, or this is a white blood-cell producing the material it needs to radically transform its three-dimensional shape as part of carrying out its assigned duty. I’m thinking it might be a combination of the two, I’m just not sure.

I am sure you will see a goofy-looking… um… protein thing if you do watch -- a Doo-dah Man truckin’ along toting a big bag full of the parts that his area of this cell was designated to make. What he’s called is a kinesin protein and he carries manufactured fabrications to be further processed, elsewhere, into the final product. I don’t know what they are or what they do mainly because molecular biology is not a prerequisite in my field of study. Pipefitting is my trade, but they could be something along the lines of an enzyme needed to change the chemical configuration of the cell’s structural components in preparation for its collapse and escape from the bloodstream. Some kind of cellular product that will know where to go, and what to do on its own, when it gets there... All in a joint effort to combat a Malaria infection, I believe.

“The ACLU [American Civil Liberties Union] sued to keep a few students in Pennsylvania from hearing about intelligent design, and as a result, they made sure everyone in the world heard about it. And that has not hurt us.”
  -- Stephen Meyer

As to the Leftist ACLU…

Image may contain: text


Cell protein and enzyme function
This video shows the change in cell function enabling a white blood cell to flatten out and squeeze between the cells of a blood vessel once it has reached its targeted designation point. Here it squeezes out of the blood stream and into the infected area. This amazingly complex processing of new information from without, signals from other independent cells with completely different jobs, shapes, and capabilities, in combination with information referenced within held in DNA. All this marvelous know-how and ability, we simply call pus.
 


All this ability and function is sourced here: aatcggcttaacacagcgcctcggat. The sequencing of molecules making up the DNA chain, tells the cell what materials it needs, how to procure them, how to use them to build protein factories, how to build the Doo-Dah Man, and how to read the encoded information necessary for all this to be. All this combinatorial effort to build and maintain you.

Image may contain: one or more people, people sitting, beard and text

“Proteins build cellular machines and structures, they carry and deliver cellular materials, and they catalyze chemical reactions that the cell needs to stay alive. Proteins also process genetic information.” 
-- Stephen C. Meyer, Signature in the Cell

Protein machine copying DNA
Said to be an adequate representation of reality in real-time of simply the most amazing thing you will ever see. This is what I refer to when I use the word; function. This is a perfectly structured, little glob of several different, chemical shapes (In scientific nomenclature; globs) compounded into a greater structure and acted on by other globs which are providing chemical or electrical stimulation to manifest motion and thus - function. This is the means in which life occurs. Without the copying of DNA, there is no life. This has to be contained before life can even think about originating. Held within the code these globs are processing are the recipes and directions on how to contain, protect, read and propagate itself. The first step in globs making globs is a glob recipe and DNA is full of them.???????




It is believed that this complex functioning and capability came about, haphazardly, in a mud puddle twenty-seven miles north of Topeka, Kansas.

DNA chain information to protein construction
This is function. Making enzymes to create chemical compounds and catalysts, used to break chemicals down in making the protein structures where about all this is to occur, is life’s process of growth. In spite of this chicken-versus-egg conundrum emerges the Doo-dah man, a protein structure with ability afforded to chemical reactions provided by enzymes, puts one foot in front of the other in giving us function. All this function, structure, know-how, and ability comes to be via “gaatgccttgcaaca’s” messaging encoded in DNA.





“In particular, the three-dimensional shape of a protein gives it a hand-in-glove fit with other equally specified and complex molecules or with simpler substrates, enabling it to catalyze specific chemical reactions or to build specific structures within the cell. Because of its three-dimensional specificity, one protein cannot usually substitute for another.” 
  -- Stephen C. Meyer

The Wonderful World of Protein Function
Different proteins doing what proteins do. Amazing machine-like workings at the molecular scale. You can see the individual molecules making up these precise and exact fabrications. Here, there is no room for error. Error or mutation coming from compromised DNA that has not been repaired or copied correctly is, far and away, classified as deleterious, which means bad and always results in a loss of function, and often – the complete loss of function to both cell and organism -- death (also bad).

The sourcing of the evolutionary process in the development of new body plans; new creatures through random mutation, is no longer considered feasible by a growing segment of the scientific community.Random Mutation and other evolutionary mechanisms are covered in Part 2a: Biological Primer.



Copying function: DNA Replication, a Visual 
This is life in essence. The process of copying DNA in order for the cell to divide is growth. The production of these copies and the maintenance and repair of its message is continuous. Priority One is maintaining the condition of the source code so that it may be passed down intact and true. Double and triple checking for accuracy along the way is built into the system. There is nothing in human technology that even laughingly compares to this molecular processing.
This is Life.
 


 

Body Code: A Visual
Several different molecular machines performing their predetermined tasks, basically, building the means necessary to provide their continuance through code. All this capability has the ability to be redirected toward different capability with additional bits and pieces here and there to tweak the machinery into new functioning. And by machinery, I mean exactly that.
 


Biological Timekeeping: Epigenetic Function - Regulation 
Things tend to get a little spooky in the dark recesses of the library when globs of chemicals start communicating with one another. Here protein librarians keep a close check on the code, making the call on what information can be read and what is to be held in reserve. This switches parts of cells on or off and is supposed to prevent your brain cells from trying to provide the biological mechanisms and abilities required by the cells that make up our sexual organs and vice versa. It’s my thinking that there may be some code confusion here in males in where thinking is supposed to originate, but I’m no epigeneticist (I don’t think anyone is). This is how Sissy gets Daddy’s eyes and her Mother’s nose.


 



Growing new teeth using stem cells - Video

 


“We interpret this as the president using his bully pulpit to support freedom of inquiry and free speech about the issue of biological origins, ... It's extremely timely and welcome because so many scientists are experiencing recriminations for breaking with Darwinist orthodoxy.”
  -- Stephen Meyer, Author - Signature in the Cell

Image may contain: meme and text

A Cry from the Wilderness 
Faith in Atheism’s Message: Decoded
                                 

Considerations
The truth is nobody alive knows for certain what all this means. Each individual has to come to grips with their own place in reality. Addressed in Pt.3: Coincidentals and Happenstance, the proposed Multiverse Theory put forth in answer to statistical anomalies noted, namely by those within the Intelligent Design community, and counter to a materialist view of nature, could very well be individual universes that come into being with conscious thought. Not that I follow this line of thought, I’m just saying. If there does exist an unknowable multitude of universes, then we each could be a prime mover in every one. The actual center of your own universe… talk about an elevated view of oneself...

I guess that would have to be a reality - one of multiple realities created to remove impossibility. Within this multiverse should lie a reality that is in complete compliance with what I want. That, I assure you, in no way describes the one we share in.

Image may contain: one or more people, people sitting, beard and text

The Paradigm of Enlightenment
In my undertaking to elevate my level of understanding in this fascinating world of molecular biology with its newly found, information-bearing quality of chemistry, now our reality, the only certainty I can find is the natural, humanistic belief in oneself and the often, arrogant, manner in which it comes across, even if unintentionally delivered. An arrogance of assumption blesses the competing mentalities of both sides in conflict over this - the crisis - invoked through engaging the dialectical means in reaching for revealed truth.

It’s possible that some DNA signatures carry a chemically enhanced, ability to see and/or believe the paranormal or religious. Some may simply lack the hard wiring needed to connect with or be in tune to what others simply experience. This would definitely be the case in one of those gazillions of other universes floating about… surely.

Who’s to say— the screwball scientist, the religious nut, or a pondering pipefitter?

The sands of paradigm and ideology constantly shift under our feet in spite of our desire for, or against, what is. Our success, satisfaction, and happiness are surely tied to the level of trust we hold in others, trust in what is, and for what could be. 

In antithesis to arrogance is fear. Common to all mankind, fear drives a need to support that which brings calm and comfort, driving off what carries discord and worry. One of the greatest of these fears is unwarranted change. Contrarily, change - when deemed necessary - is highly desired. The greatest of change on our human level is a paradigm shift.

For the love of God!
We compile emotion and belief into our self-supportive structures - the fabrications of ideology to maintain a perception of happiness. These chemically-induced, electrically-charged constructs hold the same enduring quality as a sandcastle, fading with a changing wind or disappearing completely under the brute force of an ocean wave.

The paradigm currently enveloping our New World is one dependent on hope... the vaguest of motivations. That hope was generated through a humanity centered around a manual, also based on hope - hope for the future. Contained within its text are the instructions and warnings, the means thought necessary, for the self-correction of internal flaws in the maintenance of a desired, ever-higher human-condition.

Sovereign, free and individual are the Biblical precepts piled at the base of the standing paradigm.
Correction of this is necessary?

Oh... The Humanity!
The foundation of the sand, based in support of the New World Paradigm, our American Ideal, is fired and stands through simple and vague, hope. Hope held in the blood of loved ones who sacrificed their most valued of material possessions -- the spark that brought hope unto carbon, moistened by a molecule: two parts hydrogen to each of oxygen. 

Hope, I believe held by all under the Ideal.
Instead of prayer offered with disregard for your belief, I offer a plea.

Before any more effort to remove the structuring in support, the foundation of our place, our garden amongst the wilderness, first consider the possibilities... and ramifications.
Consider the consequences.

Truth is what it is and what it is - it will always be. Truth is sovereign and men are subordinate. Nothing we think, say, or do will ever affect the reality of truth. Where there is no truth, there will be curiosity. Human nature abhors a vacuum.

What will find the void you wish to open? A foundation voided by thinking that belief is improper, believing it to be lesser than enlightened thought and the belief in unguided materialism lays open our idealistic image; sovereign, free and individual. These, which you surely cherish are also on the table.
Why flip it..?

Image may contain: one or more people and textThings on the plane of idealism bear directly down on the materialistic happenings below, evidenced by the physical reality of the Ideal we thrive under. Things that deserve respect and are to be deemed most-worthy and conserved by all who prosper in its embrace.

This is my hope... That my Faith in Atheism can be.


Next - Outside Help

 

Written by John Frost

A fundamentally transformed Leftist apostate, politically conservative; an anarchist in the realm of grammar

0 Responses

leave a reply


login to reply to thread

Sign Up
Forgot Password